ZRdb KZFP & Repeats
...

LTR_LTR22C0

  • Name
    LTR22C0
  • Repbase
    LTR22C0
  • Type
    LTR
  • Emergence
    28.9 Mya
  • Dfam Id
    DF0000459
Description :

Putative LTR of endogenous retrovirus. The LTR22 family is representedby two major subfamilies. LTRs associated with HERVK22/HERVK(HML-5)proviral loci are represented by three major subfamilies: LTR22, LTR22A,LTR22B.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtaggagatcggtcagggtggtgggaaaaattgtaggaaagatgcaaaccttcttggaaggccgggaggttttgcaaaagcttcggaagaggatttggctgaaggcagccggattctcttatccggngcctgagagcttaggttagataacaaggggatgtaaagaaactgatctagataagttagtttacttaggcctcggaacctggcctttaatcatccgcgcgcaggactgctctctccgggggtggggggggcgaccatgttaattacccacaagtgtgttgactcaaagcctttgtcattaaatctgtactgaataaatgcccgcagcgccggcttgtcagggccgcggctgctgactctttacgactctttncggcaccctcctcggtgtctgtgagcggcccggtcccctagcccgctctttcactggatacctgtgtctgagtgcattttttcatccgtcgctcggccagggtctgcgggtcggacccggca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF253 58 19.6 Moderately correlated
2 ZNF486 28 8.6 Weakly correlated
3 ZNF382 10 99.0 Weakly correlated
4 ZIM3 6 87.0 Weakly correlated
5 ZNF91 5 6.0 Weakly correlated
6 ZNF18 4 160.0 Weakly correlated
7 ZFP37 3 99.0 Weakly correlated
8 ZNF324 3 99.0 Weakly correlated
9 ZNF394 3 99.0 Weakly correlated
10 ZNF554 3 99.0 Weakly correlated
11 ZNF610 3 28.9 Highly correlated
12 ZNF557 1 15.2 Moderately correlated
13 ZNF793 1 99.0 Weakly correlated
14 ZNF766 1 43.0 Weakly correlated
15 ZNF707 1 74.0 Weakly correlated
16 ZNF701 1 28.9 Highly correlated
17 ZNF585A 1 99.0 Weakly correlated
18 ZNF558 1 99.0 Weakly correlated
19 ZFP57 1 87.0 Weakly correlated
20 ZNF479 1 6.4 Weakly correlated
21 ZFP69B 1 99.0 Weakly correlated
22 ZNF2 1 99.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF253 55 19.6 Moderately correlated
2 ZNF793 1 99.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats