ZRdb KZFP & Repeats
...

LTR_LTR22B2

  • Name
    LTR22B2
  • Repbase
    LTR22B2
  • Type
    LTR
  • Emergence
    28.9 Mya
  • Dfam Id
    DF0000457
Description :

6bp TSDs. Present in baboon & rhesus, absent from marmoset.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgttggggttcaatcaggctggtgggaaaaatattaaagatagttatagtaatagtcaaaaactctcttggaaggccntgagagtttgcatagcttcagnnattgctntggctgaaggcagccagggtctctttgcaggagccagaaagattagggtgcaagtacaaaggaatgtgggaagtttatcttactaacctgtttacttatatgggcttaagactaacctttgtcctaccgcgggtactttactgcctcctactgggnncggncgggggtcggcagaagtttattacccgcaaatggtgtttgctttaggcctcggaacctggcctttaatctttaccctctagtggtgtttactcacaacttttgttaattagtcttactgaataaatgcgagcctcactagctgatcagggccgagtcgcaactgtttacagaactcagcttggagcctgtaagcggctcggaccctcagctggactggcagagcagaatatctgtgtgtcagtgtacgtttattcatccgtcgccgagtcaggggtctgcanggaacagaccccccgcagctagtgcccccgcgaaaggagcgctgcctca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 5 99.0 Weakly correlated
2 ZFP37 4 99.0 Weakly correlated
3 ZNF2 4 99.0 Weakly correlated
4 ZNF394 4 99.0 Weakly correlated
5 ZNF679 4 28.9 Highly correlated
6 ZNF610 2 28.9 Highly correlated
7 ZNF680 2 28.9 Highly correlated
8 ZNF735 2 28.9 Highly correlated
9 RBAK 1 99.0 Weakly correlated
10 ZNF18 1 160.0 Weakly correlated
11 ZNF257 1 0.0 Weakly correlated
12 ZNF417 1 28.9 Highly correlated
13 ZNF479 1 6.4 Weakly correlated
14 ZNF480 1 43.0 Weakly correlated
15 ZNF490 1 43.0 Weakly correlated
16 ZNF723 1 15.2 Moderately correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF680 2 28.9 Highly correlated
2 ZNF735 1 28.9 Highly correlated
3 ZNF257 1 0.0 Weakly correlated
4 ZNF679 1 28.9 Highly correlated
5 ZNF479 1 6.4 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats