ZRdb KZFP & Repeats
...

LTR_LTR21B

  • Name
    LTR21B
  • Repbase
    LTR21B
  • Type
    LTR
  • Emergence
    28.9 Mya
  • Dfam Id
    DF0000451
Description :

At orthologous sites in old world monkeys, absent in new world monkeys.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgttagggtcaccccgaccagaccgttcccttcccctcccacaggccttacaatacagtcccttgcgctctccgcacagctnccccagggcaaaagacaaaccccccttcactgacccctccagtaactgtccagacagttacaggatgcggttaacatgtctgttnacctcgcataacaaagctggcaaaaaacatctccaggatgcggtcaagacacctgcacccccgactcanncggctcccccaccccgacccagtcctcctgcacccccgactcagctcccccaccccgacccggtcctggccctataaagccctgctgtagtctgtaagcggggctgcctcctctgactgtngtggagcagcccggcagctcaataaagcttgcttgcctgactttgggtctcctcgtcctttctctcggctgaccttaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF705B 3 28.9 Highly correlated
2 ZNF486 2 8.6 Weakly correlated
3 ZNF705D 2 28.9 Highly correlated
4 ZKSCAN8 1 160.0 Weakly correlated
5 ZNF175 1 94.0 Weakly correlated
6 ZNF263 1 180.0 Weakly correlated
7 ZNF382 1 99.0 Weakly correlated
8 ZNF441 1 43.0 Weakly correlated
9 ZNF490 1 43.0 Weakly correlated
10 ZNF671 1 94.0 Weakly correlated
11 ZNF679 1 28.9 Highly correlated
12 ZNF878 1 43.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF263 1 180.0 Weakly correlated
2 ZNF490 1 43.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats