ZRdb KZFP & Repeats
...

LTR_LTR1F

  • Name
    LTR1F
  • Repbase
    LTR1F
  • Type
    LTR
  • Emergence
    43.0 Mya
  • Dfam Id
    DF0000446
Description :

Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgatacggacaggaggcagggaaatactgggtagaagagggcggttccccggcaaaggccccaccctcaagcctggaaacccgcggccctaaatgggaacaggcattcctgttttcgcgcccaaatgttgccttttccaagaccacctggcccgccacgcccccctatcctgtgcccatataaaccccaaaccccaggctccacgagcagagagcagaagagcagaagagcggcagagcggcgcggcagagaaggagagaagagaaggagcgtctgaacgtcgagaggagttcggctggggacggtcggagaggagatcggccgcgggacggccgaactccaggggaagatcatcttcccactccatcccctttccagctccccatccatcccgctgagagccacctccatcactcaataaaatccccgcattcaccatccttcaagtccgtgtgacctgattcttcctggacgccggacaaggacccgggtaccaagagggcagggtgtaaaaggctgtcaccctgactctccactgagctggtttaacacttagccgtccgcggacggcaactgctaaaagagcattaattgtaacacacccctagacgctaccgtggggccggagcccaaaagcgctcgccccggctcctgcacctgcccgtctgcgtgctccccctcccgtaaggggtttgagcgcgcggcggccgagcaaacgagccacacccctgtcgcaagtcccgcgagggggtcagggaactctcccgtttca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF347 94 43.0 Highly correlated
2 ZNF680 91 28.9 Moderately correlated
3 ZNF382 5 99.0 Weakly correlated
4 ZNF479 5 6.4 Weakly correlated
5 ZNF506 4 28.9 Moderately correlated
6 ZNF274 3 99.0 Weakly correlated
7 ZNF766 2 43.0 Highly correlated
8 ZIM3 2 87.0 Weakly correlated
9 ZNF723 2 15.2 Weakly correlated
10 ZNF534 2 19.6 Weakly correlated
11 ZNF263 2 180.0 Weakly correlated
12 ZNF468 1 28.9 Moderately correlated
13 ZNF317 1 99.0 Weakly correlated
14 ZNF528 1 43.0 Highly correlated
15 ZNF549 1 87.0 Weakly correlated
16 ZNF585B 1 99.0 Weakly correlated
17 ZNF597 1 94.0 Weakly correlated
18 ZNF679 1 28.9 Moderately correlated
19 ZNF251 1 94.0 Weakly correlated
20 ZNF705B 1 28.9 Moderately correlated
21 ZNF705D 1 28.9 Moderately correlated
22 ZNF101 1 43.0 Highly correlated
23 ZKSCAN1 1 160.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF347 93 43.0 Highly correlated
2 ZNF680 30 28.9 Moderately correlated
3 ZNF534 2 19.6 Weakly correlated
4 ZNF549 1 87.0 Weakly correlated
5 ZNF468 1 28.9 Moderately correlated
6 ZNF585B 1 99.0 Weakly correlated
7 ZNF679 1 28.9 Moderately correlated
8 ZNF597 1 94.0 Weakly correlated
9 ZNF317 1 99.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats
1 ZNF347 43.0 Highly correlated
2 ZNF680 28.9 Moderately correlated