ZRdb KZFP & Repeats
...

LTR_LTR1C3

  • Name
    LTR1C3
  • Repbase
    LTR1C3
  • Type
    LTR
  • Emergence
    43.0 Mya
  • Dfam Id
    DF0000442
Description :

Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgatacagaacggctgggctcccggctaaaccccaccctcaagcctggaacctcggccctaagtgaaaacagctgaccccgtttttccgcccaaatgattgcctttttggcccgccccgcccctatcctgtgcccataaaaacagacttcagctggcagagcaacacaagcggctgatgcaagcggtcggggatgcaagctgctgagcgtcggggatacaagcggctgagcggcgagcagagaagcaactgagcgtcggagactacggatagacgcggctaacttcagacggtgcggcttcggaggggngcccggccggagacggctgggcttcagggaaagatcaccttcttcccgcaccatcccctttccaactccccatcccgccgagagccacttccatcgcccaataaagtcctccgcatacactacccttcaaacagttcgtgtgacctgattcttcctggacaccgaacaagaactcgggtgtcaaaaagggcaggtgcaggaggctgtcaccctgacccttcactgagctgttaacacttagccgtccacggactgcaggctgagtgaaacgagccactccagttcctgcccacgaagggggtcaaggtcaagggaacaatcccgtctca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF347 28 43.0 Highly correlated
2 ZNF680 17 28.9 Moderately correlated
3 ZNF705B 5 28.9 Moderately correlated
4 ZNF251 3 94.0 Weakly correlated
5 ZNF263 3 180.0 Weakly correlated
6 ZNF461 3 99.0 Weakly correlated
7 ZNF554 3 99.0 Weakly correlated
8 ZNF766 2 43.0 Highly correlated
9 ZNF479 1 6.4 Weakly correlated
10 ZNF91 1 6.0 Weakly correlated
11 ZNF723 1 15.2 Weakly correlated
12 ZNF649 1 28.9 Moderately correlated
13 ZNF506 1 28.9 Moderately correlated
14 ZFP37 1 99.0 Weakly correlated
15 ZNF382 1 99.0 Weakly correlated
16 ZNF257 1 0.0 Weakly correlated
17 ZKSCAN8 1 160.0 Weakly correlated
18 ZFP57 1 87.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF347 28 43.0 Highly correlated
2 ZNF680 7 28.9 Moderately correlated
3 ZNF251 3 94.0 Weakly correlated
4 ZFP57 1 87.0 Weakly correlated
5 ZNF257 1 0.0 Weakly correlated
6 ZNF263 1 180.0 Weakly correlated
7 ZNF723 1 15.2 Weakly correlated
8 ZNF649 1 28.9 Moderately correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats
1 ZNF347 43.0 Highly correlated