ZRdb KZFP & Repeats
...

LTR_LTR1C1

  • Name
    LTR1C1
  • Repbase
    LTR1C1
  • Type
    LTR
  • Emergence
    43.0 Mya
  • Dfam Id
    DF0000441
Description :

Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgatacagaacggctgggctcccggctaaaccccacccttaagcctggaaccgcggccctaagtgaaaacagctgaccccgtttttccgcccaaatgttgcctttttggcctgccacgcccctatcctgtgcccataaaaagacttcagctggcagagcaacacaagcggctgagcgtcggggatacaagcggctgagcgncggggatacaagcggctgagcgtcggagactacggatagacgcggctaacttcagacggtgcggcttcagggaaagatcaccttcttcccgcaccatcccctttccaactccccatcccgctgagagccacttccatcgcccaataaaatcctccgcatacactacccttcaatccgttcgtgtgacctgattcttcctggacgccggacaagaacccgggtgccgagagggcaggggcttggacgctgctgcggggcccgcacagagcctgctcccgccagagaggagcgaccggccggttccagcgttcgttccctccggttcccgcactcgcttgctcgcacgctccctctcgcgaggagtggccagcggcgggctgagtgaaacgagccactccagttcccgcccacgaagggggtcaaggtcaagggaacaatcccgtctca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF347 47 43.0 Highly correlated
2 ZNF680 44 28.9 Moderately correlated
3 ZNF251 5 94.0 Weakly correlated
4 ZNF506 5 28.9 Moderately correlated
5 ZNF282 5 319.0 Weakly correlated
6 ZNF793 3 99.0 Weakly correlated
7 ZNF317 3 99.0 Weakly correlated
8 ZFP57 2 87.0 Weakly correlated
9 ZNF534 2 19.6 Weakly correlated
10 ZNF394 2 99.0 Weakly correlated
11 ZNF382 2 99.0 Weakly correlated
12 ZFP37 2 99.0 Weakly correlated
13 ZNF334 1 99.0 Weakly correlated
14 ZNF274 1 99.0 Weakly correlated
15 ZNF264 1 99.0 Weakly correlated
16 ZNF485 1 94.0 Weakly correlated
17 ZNF486 1 8.6 Weakly correlated
18 ZNF263 1 180.0 Weakly correlated
19 ZNF133 1 99.0 Weakly correlated
20 ZNF114 1 28.9 Moderately correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF347 47 43.0 Highly correlated
2 ZNF680 20 28.9 Moderately correlated
3 ZNF251 3 94.0 Weakly correlated
4 ZNF282 3 319.0 Weakly correlated
5 ZNF793 2 99.0 Weakly correlated
6 ZNF114 1 28.9 Moderately correlated
7 ZNF534 1 19.6 Weakly correlated
8 ZNF317 1 99.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats
1 ZNF347 43.0 Highly correlated