ZRdb KZFP & Repeats
...

LTR_LTR1B1

  • Name
    LTR1B1
  • Repbase
    LTR1B1
  • Type
    LTR
  • Emergence
    43.0 Mya
  • Dfam Id
    DF0000439
Description :

Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgatacggacgggagacagggaaatactgggtagaagagggcggttccccggcaaaggccccaccctcaagcctgaanacccgcggccctaagtgaggacaggcatttctgttttcgcgcccaaaaagttgccttttggcccgccacgccccccatcctgcgcccatataaacccgagaccttagcgggcacacacacaagcggctgaacgtcgagaccagcagaccagcagaccagcgacggcggaacgacgcggcagagaaagagagaagaggagggacgtctggacgccgaggggagttcggccgggggcggtcggagaagagtccggccgctgggcggcccgactccaggggaagaccaccttcccactccatccccccttccggctccccatccatctcgctgagagccacctccaccactcaataaaaccttgcactcatccttcgagcccgcgtgtgatccgattcttccgggacactgggcaagagctcgggatacagaaggctgtcacactggccccctgcccttgcgataaggcagagggtccattgagctgattaacacacaagccgtctgcagacggcaaagctgaaagagcacgctgtaacacacgcccacttgggcttcgggagtcgcagacacccacccctagacgctgccgtggggccggagcccaaaagcgctcgccccggcctctgcacctgcccgtctgcatgctccccctaggggtttgagctgcggggcgaccaagcaggcgagccacacccctgtcgcacgtcctgcgaggggaatcagggaactctcccgtttca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF347 51 43.0 Highly correlated
2 ZNF534 12 19.6 Weakly correlated
3 ZNF680 10 28.9 Moderately correlated
4 ZNF263 8 180.0 Weakly correlated
5 ZNF28 7 28.9 Moderately correlated
6 ZNF317 7 99.0 Weakly correlated
7 ZNF274 4 99.0 Weakly correlated
8 ZKSCAN8 3 160.0 Weakly correlated
9 ZNF766 3 43.0 Highly correlated
10 ZNF793 2 99.0 Weakly correlated
11 ZNF589 2 28.9 Moderately correlated
12 ZNF445 2 99.0 Weakly correlated
13 ZNF331 2 94.0 Weakly correlated
14 ZNF334 1 99.0 Weakly correlated
15 ZNF2 1 99.0 Weakly correlated
16 ZNF283 1 99.0 Weakly correlated
17 ZNF585B 1 99.0 Weakly correlated
18 ZNF273 1 28.9 Moderately correlated
19 ZNF597 1 94.0 Weakly correlated
20 ZNF674 1 99.0 Weakly correlated
21 ZNF679 1 28.9 Moderately correlated
22 ZNF197 1 99.0 Weakly correlated
23 ZNF18 1 160.0 Weakly correlated
24 ZKSCAN1 1 160.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF347 49 43.0 Highly correlated
2 ZNF534 8 19.6 Weakly correlated
3 ZNF263 3 180.0 Weakly correlated
4 ZNF680 3 28.9 Moderately correlated
5 ZNF28 2 28.9 Moderately correlated
6 ZNF585B 1 99.0 Weakly correlated
7 ZNF334 1 99.0 Weakly correlated
8 ZNF597 1 94.0 Weakly correlated
9 ZNF674 1 99.0 Weakly correlated
10 ZNF283 1 99.0 Weakly correlated
11 ZNF317 1 99.0 Weakly correlated
12 ZNF793 1 99.0 Weakly correlated
13 ZNF273 1 28.9 Moderately correlated
14 ZNF589 1 28.9 Moderately correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats
1 ZNF347 43.0 Highly correlated