ZRdb KZFP & Repeats
...

LTR_LTR1B0

  • Name
    LTR1B0
  • Repbase
    LTR1B0
  • Type
    LTR
  • Emergence
    43.0 Mya
  • Dfam Id
    DF0000438
Description :

Very close to LTR1B, but with (among others) an 80 bp deletion.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgatacggacaggagacagggaaatactgggtagaagagggcggttccccggcaaaggccccaccctcaagcctggagacccgcggccctaaatggggacaggcattcctgttttcgcgcccaaaaagttgccttttggcccgccacgccccctatcctgtacccatataaaccccgaaccccaggctccagaagcagacgagcagacgagcgaggagacaagcagacgaacggcggaacgacgcggcagagaaagagaggaggaacgtctgaacgccgagaggagttcggctgggggcggtcggagaggagttcggccgctggacggccaaactccaggggaagatcatcttcccactccatccccccttccggctccccatccatcccgctgagagccacctccaccactcaataaaacccccgcattcatccttcaagtccgtgtgtgacccgattcttccgggacgctggacaagagctcgggatacagaaagctgtcacactggccctctgcccttgcagaaaggcagagggtccactgagctggttaacactcaagccgtccgcggacggcaaggctaaaagggcacactgtaacacacgcccacttgggctcctgcacctgtccgtctgcgtgctccccctcccgtaaggggtttgagcagcggcggcgaccgaacaggcgagccacacccctgtcgcacgtcctgcgagggggtcagggaactctcccgtttca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF347 46 43.0 Highly correlated
2 ZNF680 25 28.9 Moderately correlated
3 ZNF263 8 180.0 Weakly correlated
4 ZNF705B 3 28.9 Moderately correlated
5 ZNF382 3 99.0 Weakly correlated
6 ZNF468 2 28.9 Moderately correlated
7 ZNF705D 2 28.9 Moderately correlated
8 ZNF282 2 319.0 Weakly correlated
9 ZNF331 1 94.0 Weakly correlated
10 ZNF320 1 28.9 Moderately correlated
11 ZIM3 1 87.0 Weakly correlated
12 ZNF471 1 94.0 Weakly correlated
13 ZNF479 1 6.4 Weakly correlated
14 ZNF506 1 28.9 Moderately correlated
15 ZNF519 1 19.6 Weakly correlated
16 ZNF677 1 99.0 Weakly correlated
17 ZNF701 1 28.9 Moderately correlated
18 ZNF274 1 99.0 Weakly correlated
19 ZNF251 1 94.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF347 44 43.0 Highly correlated
2 ZNF680 12 28.9 Moderately correlated
3 ZNF263 3 180.0 Weakly correlated
4 ZNF468 2 28.9 Moderately correlated
5 ZIM3 1 87.0 Weakly correlated
6 ZNF331 1 94.0 Weakly correlated
7 ZNF479 1 6.4 Weakly correlated
8 ZNF282 1 319.0 Weakly correlated
9 ZNF677 1 99.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats
1 ZNF347 43.0 Highly correlated