ZRdb KZFP & Repeats
...

LTR_LTR14A

  • Name
    LTR14A
  • Repbase
    LTR14A
  • Type
    LTR
  • Emergence
    28.9 Mya
  • Dfam Id
    DF0000410
Description :

Internal retroviral sequence has been found in GenBank sequence AC003072(position 23535 <- 27344).
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgggagaaaagctgagtgttgggagagaagctgaggcagggcttgcatgtctgctagacttgctggctccttgcttctagcactcccattatctcaagcagccatatgtttctcattcacttgatacaccgtttcctttcaacccccacatcctcaccacctgtttctttgtttgagcaccaataaatagcgtgggctcccagagctcggggccttcgcagcctccacactcgcgatggccccctggtcccactttctctctcaaactgtctttttctcattcctttgactccgccggacttcgtcgcccccacgacctggtgttgggtctgatcaccccaaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF320 182 28.9 Highly correlated
2 ZNF793 17 99.0 Weakly correlated
3 ZNF534 8 19.6 Moderately correlated
4 ZNF28 7 28.9 Highly correlated
5 ZNF679 6 28.9 Highly correlated
6 ZNF479 6 6.4 Weakly correlated
7 ZNF589 4 28.9 Highly correlated
8 ZNF317 4 99.0 Weakly correlated
9 ZNF382 3 99.0 Weakly correlated
10 ZNF587 3 28.9 Highly correlated
11 ZNF816 3 28.9 Highly correlated
12 ZIM3 3 87.0 Weakly correlated
13 ZNF394 2 99.0 Weakly correlated
14 ZNF417 2 28.9 Highly correlated
15 ZNF766 2 43.0 Weakly correlated
16 ZNF823 2 43.0 Weakly correlated
17 ZNF92 2 28.9 Highly correlated
18 ZNF485 1 94.0 Weakly correlated
19 ZNF778 1 74.0 Weakly correlated
20 ZNF765 1 8.6 Weakly correlated
21 ZNF723 1 15.2 Moderately correlated
22 ZNF584 1 99.0 Weakly correlated
23 ZNF547 1 74.0 Weakly correlated
24 ZFP37 1 99.0 Weakly correlated
25 ZNF251 1 94.0 Weakly correlated
26 ZNF18 1 160.0 Weakly correlated
27 ZNF141 1 43.0 Weakly correlated
28 ZKSCAN1 1 160.0 Weakly correlated
29 ZFP57 1 87.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF320 64 28.9 Highly correlated
2 ZNF534 7 19.6 Moderately correlated
3 ZNF793 3 99.0 Weakly correlated
4 ZNF417 2 28.9 Highly correlated
5 ZIM3 1 87.0 Weakly correlated
6 ZNF485 1 94.0 Weakly correlated
7 ZNF816 1 28.9 Highly correlated
8 ZNF823 1 43.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats
1 ZNF534 19.6 Moderately correlated