ZRdb KZFP & Repeats
...

LTR_LTR12B

  • Name
    LTR12B
  • Repbase
    LTR12B
  • Type
    LTR
  • Emergence
    28.9 Mya
  • Dfam Id
    DF0000401
Description :

LTR from human class I HERV9 endogenous retrovirus (HRES-1/1). R66-likefragment at positions 78-143 may expand into multiple copies.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgagaggtgaagccagctggacttcctgggtcgagtggggacttggagaacttttctgtctagctagaggattgtaaaannntgcaccaatcagcgctctgtgtctagctaaaggattgtaaacgcaccaatcagcactctgtaaaaatggaccaatcagcgctctgtaaaatggaccaatcagcaggacgtgggcggggacaaataagggaataaaagctggccaccccagccagcagcggcaacccgctcgggtccccttccacgctgtggaagctttgttctttcgctcttcacaataaatcttgctgctgctcactctttgggtccgcgccacctttaagtgctgtaacactcaccgcnaaggtctgcagcttcattcttgaagtgagcaagaccatgaacctgccagaaggaagaaacaactctggacataacacctttaagtgctgtaacactcaccgcnaaggtctgcagcttcattcttgaagtgagcaagaccatgaacctgccagaaggaagaaactctggacacatctgaacgnncgnnggaacaaactctggacataacacctttaagtgctgtaacactcaccgcnaaggtctgcagcttcattcttgaagtgagcaagaccatgaacctgccagaaggaagaaactctggaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF669 14 43.0 Weakly correlated
2 ZNF479 6 6.4 Weakly correlated
3 ZIM3 5 87.0 Weakly correlated
4 ZNF793 4 99.0 Weakly correlated
5 ZFP57 3 87.0 Weakly correlated
6 ZNF382 2 99.0 Weakly correlated
7 ZNF558 2 99.0 Weakly correlated
8 ZNF786 2 99.0 Weakly correlated
9 ZNF251 1 94.0 Weakly correlated
10 ZNF257 1 0.0 Weakly correlated
11 ZNF263 1 180.0 Weakly correlated
12 ZNF317 1 99.0 Weakly correlated
13 ZNF394 1 99.0 Weakly correlated
14 ZNF441 1 43.0 Weakly correlated
15 ZNF44 1 43.0 Weakly correlated
16 ZNF17 1 69.0 Weakly correlated
17 ZNF141 1 43.0 Weakly correlated
18 ZNF723 1 15.2 Moderately correlated
19 ZNF735 1 28.9 Highly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF479 6 6.4 Weakly correlated
2 ZIM3 3 87.0 Weakly correlated
3 ZFP57 1 87.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats