ZRdb KZFP & Repeats
...

LTR_LTR108E_MAM

  • Name
    LTR108E_MAM
  • Repbase
    No find
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000388
Description :

LTR108e_Mam has 5 bp TSDs with a preference for GNNNC. The substitutionlevel found in the Laurasiatherian reconstruction is ~27%.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtgtaaggatagggttaacttgcagctggtctgtggtagctctgtgcttatctccggggatgcctggaancntggtactgacccttggccaagatagggatgaaatgtactagctagtgatttataatgtgctgtttaaagtccgaaactcccctggaggcancctgtaccagcttgtctacattgtttattgaaaatgtatagattgatggtttgcacctggtttaaccggttacgcagcctggttttggctacgtgaccagcggggtataaaagacccctcagtaaacttgtgccttggctcccctgagaccaaggtatctcgcacgtatcttggtggttcataatccgaagacgaagcgcgtcctgtgcgactgagaaaggaccctgggagctgcgcctggaagtcttncggacctccgatgtttgcctgcgctttctttctcctgctgtaccgtatcctttacctttattaaagccttacgtgagtataccctgtggagtctcgtgagtcctttcaattatccgaccctgtgtaattgctgca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF317 3 99.0 Highly correlated
2 ZNF394 3 99.0 Highly correlated
3 ZNF479 3 6.4 Weakly correlated
4 ZNF766 3 43.0 Weakly correlated
5 ZKSCAN8 2 160.0 Weakly correlated
6 ZNF101 2 43.0 Weakly correlated
7 ZNF175 2 94.0 Moderately correlated
8 ZNF197 2 99.0 Highly correlated
9 ZNF584 2 99.0 Highly correlated
10 ZNF589 2 28.9 Weakly correlated
11 ZNF679 2 28.9 Weakly correlated
12 ZIM3 1 87.0 Moderately correlated
13 ZKSCAN1 1 160.0 Weakly correlated
14 ZNF18 1 160.0 Weakly correlated
15 ZNF263 1 180.0 Weakly correlated
16 ZNF382 1 99.0 Highly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF479 3 6.4 Weakly correlated
2 ZNF766 1 43.0 Weakly correlated
3 ZNF679 1 28.9 Weakly correlated
4 ZNF18 1 160.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats