ZRdb KZFP & Repeats
...

LTR_LTR108D_MAM

  • Name
    LTR108D_MAM
  • Repbase
    No find
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000387
Description :

LTR108d_Mam has 5 bp TSDs with a preference for GNNNC. The substitutionlevel found in the Laurasiatherian reconstruction is ~26%.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtgtaagatagagttatcttacagctggactgggacagctctgtgcttatctccggggatgcctggaagtctggtactgacccttggccaagataaggatgagatgggctagctagtgatttataatgtgctgtttaaagttcgaaactcccctggnggcacccagggccagcttgtttacattgtttagggatgtatagattgatggcttacacctggtttaaccggttacacagcctggcttggctacgtgaccagtggggcataaaagaccccgctggaaacttttgcccgagctctcctgaaaccaagattcctcgcacatatcttggtggttcataatccggagacgaagcgcgtcctgtgcgactgagaaaggaccctggggagctgcgcctggaagtctctcgggcccccgatgcttgcctgcgctttctttctcctgctgtaccgtatcctttacctttattaaagccttacgtgagtacgccctgtggagtcttgtgagtcctttcaattatccgaccctgtgtaatcgntgca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 3 99.0 Highly correlated
2 ZFP37 2 99.0 Highly correlated
3 ZNF263 2 180.0 Weakly correlated
4 ZNF766 2 43.0 Weakly correlated
5 ZNF793 2 99.0 Highly correlated
6 ZKSCAN8 1 160.0 Weakly correlated
7 ZNF18 1 160.0 Weakly correlated
8 ZNF534 1 19.6 Weakly correlated
9 ZNF584 1 99.0 Highly correlated
10 ZNF723 1 15.2 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF793 2 99.0 Highly correlated
2 ZNF263 1 180.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats