ZRdb KZFP & Repeats
...

LTR_LTR108A_MAM

  • Name
    LTR108A_MAM
  • Repbase
    No find
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000384
Description :

LTR108a_Mam has 5 bp TSDs, with a preference for GNNNC. Thesubstitution level found in the Laurasiatherian reconstruction is ~21%.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtgtaggatagagttgatttacagctggactgggaaagctctatctttatctctggggacgcctggatgtctggctttgactcttggccaagataagggcagtgggatttatgatgtgctgtttaaagtccgaaactcccctggcgacccccagggtcagtttgtttactgatggttttcanctggcntaaccggttagacagcctggcttgactacgtgaccagaggggcataaaagaccccgctgggaacttctgccttgagctctcccgaagccaagattcctcgcacagatcttggtggttcaatccggagacgaagcgcgtcctgtgtgcgaataaggaccctggggagcttgcgcctggatgtctctcggacccccaatgcttgcctgcactctctttctcttgctgcaccgtatcctttgcctttaaataaaagccttacgtgagtatgctctgtggagtctggtgagtcctttcaaatatccgaacttgngaaatctttgca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF701 3 28.9 Weakly correlated
2 ZIM3 1 87.0 Moderately correlated
3 ZNF251 1 94.0 Moderately correlated
4 ZNF479 1 6.4 Weakly correlated
5 ZNF485 1 94.0 Moderately correlated
6 ZNF547 1 74.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZIM3 1 87.0 Moderately correlated
2 ZNF701 1 28.9 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats