ZRdb KZFP & Repeats
...

LTR_LTR107_MAM

  • Name
    LTR107_MAM
  • Repbase
    No find
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000383
Description :

LTR107_Mam has 4 bp TSDs; it cannot be clearly associated with any classof retrotransposon.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgttgtggaaaanaagaccacagactcagaatttaaaaacaagactttgccgtttataagaactgcattgcaggaaggaaggaggggagtgctcaccagccagaggctggggaccaccacaccagttccttaacacatcaaaattacaggctttcttttatacatgagtacaacctaagaccccctccaagaattgccttgtggtcagcaggggaggaggggcctcgtgacactcaggtagggaagangagacctcgtgacgctcagcagggaaggggagggcggaccttgtagtcataagttagcaaacttcaaaaaggctatttgaaaggggtgctgataacatacatttgaaagaggtcacagtatttgtccagtaaaacattnaggatctataaagaggtcacagtatttgtccaggggaataaaacattgaagatctataaaggggtcacggtgtttgtccaggggagtaaaacattaaggatctctttgttagttgagatttttaacttttagaatacgtgacatgaagttctgttgattatggaggggctgatttcctcatca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF589 4 28.9 Weakly correlated
2 ZNF766 3 43.0 Weakly correlated
3 ZNF677 3 99.0 Highly correlated
4 ZNF584 3 99.0 Highly correlated
5 ZNF317 3 99.0 Highly correlated
6 ZNF382 3 99.0 Highly correlated
7 ZFP37 2 99.0 Highly correlated
8 ZNF705B 2 28.9 Weakly correlated
9 ZNF263 2 180.0 Weakly correlated
10 ZNF394 2 99.0 Highly correlated
11 ZNF92 1 28.9 Weakly correlated
12 ZNF723 1 15.2 Weakly correlated
13 ZNF680 1 28.9 Weakly correlated
14 ZNF567 1 99.0 Highly correlated
15 ZNF490 1 43.0 Weakly correlated
16 ZNF486 1 8.6 Weakly correlated
17 ZNF479 1 6.4 Weakly correlated
18 ZNF425 1 94.0 Moderately correlated
19 ZNF324 1 99.0 Highly correlated
20 ZNF28 1 28.9 Weakly correlated
21 ZNF251 1 94.0 Moderately correlated
22 ZNF18 1 160.0 Weakly correlated
23 ZNF175 1 94.0 Moderately correlated
24 ZNF101 1 43.0 Weakly correlated
25 ZKSCAN1 1 160.0 Weakly correlated
26 ZIM3 1 87.0 Moderately correlated
27 ZFP69B 1 99.0 Highly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZIM3 1 87.0 Moderately correlated
2 ZNF490 1 43.0 Weakly correlated
3 ZNF705B 1 28.9 Weakly correlated
4 ZNF677 1 99.0 Highly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats