ZRdb KZFP & Repeats
...

LTR_LTR106_MAM

  • Name
    LTR106_MAM
  • Repbase
    No find
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000382
Description :

LTR106_Mam cannot be clearly associated with any class ofretrotransposon.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtcgtggaaaatcgagattctgcattgtgttttaaagttaatctgttagagtcacttattattttacttgtaaaataacttttacaaggaggaatgcctttagntatgttcctaattttaagagaatctgcacagtcttttatactggttgagttaattagaacnagatcagtgaggtcatagtcagtgggttaattatcacaaggttggtgagtaaaatcaacctcctatgacaaacatagtttacaactttaagtgaacaaacacagttttctacaacaaacattctaacaaatgtagtttcctataacaaacattcatagtctcaaggttacaagtcaacagtccttggaactattaaaacaaacctttcaatattacaggaaagctctttgccctttttagtaaacagacttagacagaaactcaactttatgatgacaagatacagaataagtatagatttaacttaaattttatggtaactggtatgtaaatattcnctaaccttcttccttatctntctaaacaaagggtaatggctagcccagtgctttgcattctcaaaagcacttgtgtcaacagcttccctttctctcaaggtttctcattaaatgctattgaaacttgtggcctntggtttcaactataattttaaccaaggctgaatcaaagatatttggggcttataatnntttatttccaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 23 99.0 Highly correlated
2 ZNF394 9 99.0 Highly correlated
3 ZKSCAN1 7 160.0 Weakly correlated
4 ZNF766 7 43.0 Weakly correlated
5 ZIM3 5 87.0 Moderately correlated
6 ZNF2 4 99.0 Highly correlated
7 ZNF558 4 99.0 Highly correlated
8 ZFP69B 3 99.0 Highly correlated
9 ZNF18 3 160.0 Weakly correlated
10 ZNF723 3 15.2 Weakly correlated
11 ZNF534 3 19.6 Weakly correlated
12 ZNF92 2 28.9 Weakly correlated
13 ZFP37 2 99.0 Highly correlated
14 ZNF584 2 99.0 Highly correlated
15 ZNF554 2 99.0 Highly correlated
16 ZNF101 2 43.0 Weakly correlated
17 ZNF490 1 43.0 Weakly correlated
18 ZNF41 1 99.0 Highly correlated
19 ZNF324 1 99.0 Highly correlated
20 ZNF585A 1 99.0 Highly correlated
21 ZNF589 1 28.9 Weakly correlated
22 ZNF610 1 28.9 Weakly correlated
23 ZNF705D 1 28.9 Weakly correlated
24 ZNF28 1 28.9 Weakly correlated
25 ZNF251 1 94.0 Moderately correlated
26 ZNF786 1 99.0 Highly correlated
27 ZNF81 1 99.0 Highly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZIM3 3 87.0 Moderately correlated
2 ZFP37 2 99.0 Highly correlated
3 ZNF723 2 15.2 Weakly correlated
4 ZNF554 1 99.0 Highly correlated
5 ZNF81 1 99.0 Highly correlated
6 ZNF534 1 19.6 Weakly correlated
7 ZNF41 1 99.0 Highly correlated
8 ZNF558 1 99.0 Highly correlated
9 ZNF766 1 43.0 Weakly correlated
10 ZNF584 1 99.0 Highly correlated
11 ZNF585A 1 99.0 Highly correlated
12 ZNF610 1 28.9 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats