ZRdb KZFP & Repeats
...

LINE_L2-1_CRP

  • Name
    L2-1_CRP
  • Repbase
    L2-1_Crp
  • Type
    LINE
  • Emergence
    319.0 Mya
  • Dfam Id
    DF0001331
Description :

Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
gcttgctctctatgcttcnctcctccccacttnactcttttgcccctctctcccattgcaaggtctgctgcaccttcagccctggctcacccccaacatccgcttcctctgctcctgctctcgcgctgcagagcatctctggcggaaatcccgtgaccaggctgacttcctccactacaaattcgttctctcctccttcagttctgccatcttcctagctaaacaactctacttctccaacttaattgaatcccacgcccgcaatccccgccttttcgccacttgactcactcctcaccaccctttcctgcctccacttctctctccgcacaggatctcaccgatttcttccaagagaaaactgacaaaatacgacgtgacctcctcctcccctcggcttgcctcccttcttccctctcctacaatcttctcctcttctcccctgtcacagacgcgaagtttcttctttctcttccctctaaccccccagtgaccccntcccatcccatctcctgatcccttcacgtccactctcatcccctcccttactcttctccttaacctcttctgcctctgcttttccctcacaatacaaacatgctttagtctctcccatcttaaaaaaaacccttgaccccacttgcctctccaccaccccatctccnctctccctttcatctctaagctcattgaacgcgctgtttacaatcgctgtctggagttcctctcctccagttcccaccctcactccagcttctgccccttcttccactgaaatctaatgtcttgccaaagtctctaatgactctttctagccaaanctcagaaccagtactccatcctcatcctccttgacctgtcagccttcgacacagtcgaccactgctcttcttgaaatcttgtcctcccttggcttccgtgactgtcctctcctggttctccttctttcctcttgccttttccttcggaggatctcctcatccccttccaactttcgcngaaaccctggctccacttgctccctttcctttctcctccncagtnacatctctgggtaatctcatctgcaaaccaaaccgtatatcttcatggactcgcagatctacactctctactccagacctgtctccttctgtccaaataaaatctcggcctgtctctccgacgtctcctcgtggtattgtgccagctcaacatggctaaaacgggatctnttaatctacctncccatccccacccct
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZFP37 2 99.0 Weakly correlated
2 ZNF317 2 99.0 Weakly correlated
3 ZNF382 2 99.0 Weakly correlated
4 ZNF680 2 28.9 Weakly correlated
5 ZNF101 1 43.0 Weakly correlated
6 ZNF263 1 180.0 Weakly correlated
7 ZNF2 1 99.0 Weakly correlated
8 ZNF394 1 99.0 Weakly correlated
9 ZNF534 1 19.6 Weakly correlated
10 ZNF554 1 99.0 Weakly correlated
11 ZNF616 1 43.0 Weakly correlated
12 ZNF84 1 99.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZFP37 1 99.0 Weakly correlated
2 ZNF554 1 99.0 Weakly correlated
3 ZNF680 1 28.9 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats