ZRdb KZFP & Repeats
...

LINE_L1P3B_5END

  • Name
    L1P3B_5END
  • Repbase
    No find
  • Type
    LINE
  • Emergence
    43.0 Mya
  • Dfam Id
    DF0000319
Description :

Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
ggggggcggggccaagatggccgactagaagcagcggcgntcggaggctcccatcgaaaagaaccataataagcgtgtgaatccttcaccggcaaccaaggtatccaggttctctcatcagaactgactaggaggctggcgtgacccacggagagaaggaagagcagtgtggtgcggcggcccacctgagagccacacggggcaggggagcccccnccccccagccaagggaggcggtgagtgagcgtgctacccagccggggaaaccgtgctttttccacggaactgtgcaacccacggatcggaagatcccactcgcgaacccacgccaccggggcctagcgtcccaaccccggagccgcgcagattctcaacagcctctcagctggaatctgcttaagcctgccgagctcccggggggaggggcgaccagcaccacggctgcggctgcctgctgtctaagccgtttgagctccttgggggaggggcagcagccagcactgggactcgcaactgcctaacacgctaagctccctgggcgggggaagggcggcacccatctctatagctccaggccgcgcttttcccctgctggagccagggaggctggacggcttggtcccaaganntgtccccacagcccaacacaccggctgtggcagnctgcggccagagtgcctcttcaggcctgaccctgacccatccttcctcactgggcggggcttccctgcaggaactccaataactccagccagaggctcagggacagaactcggatctccctgggcctgagcccctagggggaggggtggccgcagtctctgcggaccagcagacttagcctttcctcctggtagttctgaggaatccgggcagcccagacgagtgggtttccccccagcgaagcacaccccctccaccaagggacaaagtgcttcgttaaacgggtcctgctccccgtgccacccaactgggtgagaccctccaacaggggttgtcagacaccctatacaggagcgatcctactggcatcaggttggtgcccctcgaggtcagaggtcccagaagaaggagcaggcacccatctttgctgttctccagcctccttgagtgacatctccaggcgcgggagcgaaccaga
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 3 99.0 Weakly correlated
2 ZNF519 3 19.6 Weakly correlated
3 ZNF793 2 99.0 Weakly correlated
4 ZIM3 2 87.0 Weakly correlated
5 ZNF490 1 43.0 Highly correlated
6 ZNF91 1 6.0 Weakly correlated
7 ZNF766 1 43.0 Highly correlated
8 ZNF679 1 28.9 Moderately correlated
9 ZNF611 1 19.6 Weakly correlated
10 ZNF597 1 94.0 Weakly correlated
11 ZNF534 1 19.6 Weakly correlated
12 ZNF528 1 43.0 Highly correlated
13 ZNF479 1 6.4 Weakly correlated
14 ZNF468 1 28.9 Moderately correlated
15 ZNF28 1 28.9 Moderately correlated
16 ZNF274 1 99.0 Weakly correlated
17 ZNF18 1 160.0 Weakly correlated
18 ZNF141 1 43.0 Highly correlated
19 ZNF114 1 28.9 Moderately correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF793 2 99.0 Weakly correlated
2 ZIM3 1 87.0 Weakly correlated
3 ZNF141 1 43.0 Highly correlated
4 ZNF28 1 28.9 Moderately correlated
5 ZNF519 1 19.6 Weakly correlated
6 ZNF468 1 28.9 Moderately correlated
7 ZNF479 1 6.4 Weakly correlated
8 ZNF597 1 94.0 Weakly correlated
9 ZNF18 1 160.0 Weakly correlated
10 ZNF534 1 19.6 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats