ZRdb KZFP & Repeats
...

LTR_HERV1_LTRD

  • Name
    HERV1_LTRD
  • Repbase
    No find
  • Type
    LTR
  • Emergence
    43.0 Mya
  • Dfam Id
    DF0000167
Description :

Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgaagtgggaaattaagaaaataacagaataatagcataagtaataatagtaaagattatagtaatagtnagagaaataacaatagctcatagaatgaattgctgtattaaccaaggctaaaaagaatttaagtagcccccccgaagttaaagttagaagagaatattaactgtctgtcccaagaaacattaaccatatctaccctccacatattttgtaggctctgtaaactcctgtttctttcttccctgcacagctgcaaggtcacaagacagataagcataagctgcaaaccaagttctcccagagatgtaagacatgttgcaaaagtgtcacagcagcctttgttctcgcttctgtaagcctgcttcctgcttcacgtagtncccgcctcaaaatgcttaaaagggactcgttttctttgttctgggctcagactttcaggacacatgtccgctgggccggtgtacaccttaaaataaacactttcctgcactccgtccggtctctccggttccttaatttcccgcaaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF766 7 43.0 Highly correlated
2 ZNF589 5 28.9 Moderately correlated
3 ZNF175 4 94.0 Weakly correlated
4 ZKSCAN8 3 160.0 Weakly correlated
5 ZNF197 2 99.0 Weakly correlated
6 ZNF274 2 99.0 Weakly correlated
7 ZNF382 2 99.0 Weakly correlated
8 ZFP37 1 99.0 Weakly correlated
9 ZKSCAN1 1 160.0 Weakly correlated
10 ZNF101 1 43.0 Highly correlated
11 ZNF18 1 160.0 Weakly correlated
12 ZNF394 1 99.0 Weakly correlated
13 ZNF558 1 99.0 Weakly correlated
14 ZNF584 1 99.0 Weakly correlated
15 ZNF680 1 28.9 Moderately correlated
16 ZNF701 1 28.9 Moderately correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF589 2 28.9 Moderately correlated
2 ZNF101 1 43.0 Highly correlated
3 ZNF175 1 94.0 Weakly correlated
4 ZNF197 1 99.0 Weakly correlated
5 ZNF18 1 160.0 Weakly correlated
6 ZNF274 1 99.0 Weakly correlated
7 ZNF584 1 99.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats