ZRdb KZFP & Repeats
...

LTR_HERV1_LTRC

  • Name
    HERV1_LTRC
  • Repbase
    No find
  • Type
    LTR
  • Emergence
    28.9 Mya
  • Dfam Id
    DF0000166
Description :

Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgaagaaggaattaatgaaatcaactataacctaatagtagtagtaatagaaattttaaaatcctcttaaagttgctgcaaagtgtgaccccccccttacactcaagttaaaagagaatattaacagcctgtcttctctctgtggacagtggaccttatctatactccccaactccacattcctcaaagtttattacaggcccagcgagttcctgcacggctgcagggtcacaagaccgataagtttaggttgcaagacatgtttctctcaagatgtaagaaatgttgtaatgctgcctttgtttcttgcttctgtaactcgcttcccgcctcacgtagttcccgccttaagatgtttaaaagtaggaaaagccctttgttcggggctcagactttctggacatatgtccggctgagccggtgatcaccttaatttaataaactctcctgaacctttttcggtctctccagtctttgattgtcccgcaaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF766 26 43.0 Weakly correlated
2 ZNF589 15 28.9 Highly correlated
3 ZNF175 14 94.0 Weakly correlated
4 ZNF584 9 99.0 Weakly correlated
5 ZNF382 7 99.0 Weakly correlated
6 ZKSCAN8 6 160.0 Weakly correlated
7 ZNF197 6 99.0 Weakly correlated
8 ZKSCAN1 5 160.0 Weakly correlated
9 ZNF701 2 28.9 Highly correlated
10 ZNF793 2 99.0 Weakly correlated
11 ZNF274 1 99.0 Weakly correlated
12 ZNF506 1 28.9 Highly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF175 6 94.0 Weakly correlated
2 ZNF589 6 28.9 Highly correlated
3 ZNF584 5 99.0 Weakly correlated
4 ZNF197 3 99.0 Weakly correlated
5 ZNF506 1 28.9 Highly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats
1 ZNF175 94.0 Weakly correlated
2 ZNF589 28.9 Highly correlated