ZRdb KZFP & Repeats
...

LTR_HERV1_LTRB

  • Name
    HERV1_LTRB
  • Repbase
    HERV1_LTRb
  • Type
    LTR
  • Emergence
    28.9 Mya
  • Dfam Id
    DF0000165
Description :

Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgaagggggaattaatgaattttataagtataatagtcgagaaatttattcttttccttgaaggtagaatgtaatatagccccccaacccggaggcctgggttaagagagaatattaactgcttatttctcctctatgcncagagaggcttatctgtgttccatcgtttcacattccttgaggcacggcgagttcttgcttccctccctagcgcggctgtaaagtcacaaggttgataagcaantgctacaaaagcatgtattcccaaggatgtaagacatgtggtgtaacaaatgtaaaagagtaattaactgcctttgttctcgcttccgcaagtacgcttcctgcagcacgtaactcccgccacaaactgcttaaaaggtgattgatccctttgttcggggctcagactttctggaccctagtccgactgagccggtgatcaccttaataataaagggctctcctgaactctgctcggtctctcccgtctctgatttgtcccgcaaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF429 1 28.9 Highly correlated
2 ZNF506 1 28.9 Highly correlated
3 ZNF534 1 19.6 Moderately correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats