ZRdb KZFP & Repeats
...

LTR_HERV1_LTRA

  • Name
    HERV1_LTRA
  • Repbase
    HERV1_LTR
  • Type
    LTR
  • Emergence
    28.9 Mya
  • Dfam Id
    DF0000164
Description :

Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgaagaaggaattcatgaattttacaagtataatcaaagacaaccaagaaatttttactttttccttcaaaagctaagtgtagtgtagcccccacccgtagtctaagttagagaagaatactaactgcctgtttttccttctgtgctcagcgagccttatctgtactcgccagtttcacattccttgaggctcagcgagttcctgcttcacctccctagcgcagctgcaaagttacaaggttgatacgcgnncgncgcagaaacatggtttcccagggatgtggaacatgtagtatagataaatgtaaaagactgatcaactgcctttgttctcgcttctgtaagtacgcttcctgcatcacgtagctcccggccactgactgcttaaaaggtggctgctttctttgtccggggctcagactttcctggacgctagtcctactgagccaggtgatcaccttttaataaagacctttcctgaactctgttcggtctctcccatctctgattgtcccgcaaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF766 16 43.0 Weakly correlated
2 ZNF274 12 99.0 Weakly correlated
3 ZNF175 10 94.0 Weakly correlated
4 ZNF197 10 99.0 Weakly correlated
5 ZNF589 10 28.9 Highly correlated
6 ZKSCAN8 8 160.0 Weakly correlated
7 ZNF584 7 99.0 Weakly correlated
8 ZKSCAN1 5 160.0 Weakly correlated
9 ZNF382 3 99.0 Weakly correlated
10 ZNF793 2 99.0 Weakly correlated
11 ZNF92 1 28.9 Highly correlated
12 ZFP37 1 99.0 Weakly correlated
13 ZNF701 1 28.9 Highly correlated
14 ZNF680 1 28.9 Highly correlated
15 ZNF585A 1 99.0 Weakly correlated
16 ZNF534 1 19.6 Moderately correlated
17 ZNF506 1 28.9 Highly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF197 6 99.0 Weakly correlated
2 ZNF589 5 28.9 Highly correlated
3 ZNF175 5 94.0 Weakly correlated
4 ZNF584 4 99.0 Weakly correlated
5 ZNF793 2 99.0 Weakly correlated
6 ZNF534 1 19.6 Moderately correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats
1 ZNF197 99.0 Weakly correlated