ZRdb KZFP & Repeats
...

LINE_CR1-13_AMI

  • Name
    CR1-13_AMI
  • Repbase
    CR1-13_AMi
  • Type
    LINE
  • Emergence
    319.0 Mya
  • Dfam Id
    DF0001291
Description :

Fragment.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
aaaaagggattagaaaataatactgaanatantataatgccattatataaatcgatggtgcacttcacttgaataccgcgttcagttctggtcaccctatctcaaagaaatanagcagaaataaggagttcgagacgggcgacgaaaatgattagaggcagagagacttccatatgaagagagantgaagactggactgtttagtttagagaggagacgaatgaggggacatgatagaggtatacaaaataatgaatggacaggggagcaatcgggagctcctatttaccctttctcataatacaagaacaaggacattcaatgaaattgaaaggcaacaatttaaaactgataaaaggaaatactttttttacacaatgcataattaacctgtggaactcactgccacaagatatcactgaggccaagagcttagcaggattcaaaaaggattagacatttatatggataacgagaacatccgcagttacattagataggataaaaaatataagggatataancctcatgcttcagggcataagccaaccactaactgacggggttaggaagaaacttcccctatgggcaggttattccataattgccattatggggnttttgcaccttcctctgaagcatctggtactggccactgtcagagacaggatactggactagatggaccactggtcattccactatngcgaattaattgttctta
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 7 99.0 Weakly correlated
2 ZNF394 4 99.0 Weakly correlated
3 ZFP69B 2 99.0 Weakly correlated
4 ZNF75D 2 94.0 Weakly correlated
5 ZFP57 1 87.0 Weakly correlated
6 ZKSCAN1 1 160.0 Weakly correlated
7 ZNF257 1 0.0 Weakly correlated
8 ZNF263 1 180.0 Weakly correlated
9 ZNF558 1 99.0 Weakly correlated
10 ZNF680 1 28.9 Weakly correlated
11 ZNF727 1 19.6 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZFP57 1 87.0 Weakly correlated
2 ZNF257 1 0.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats